p2T-CMV-HNHx-ABE8eHD-BlastR
(Plasmid
#176478)
-
PurposeA-to-G base editor with alternative targeting scope
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonep2T-CMV-BlastR
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHNHx-ABE8eHD
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2T-CMV-HNHx-ABE8eHD-BlastR was a gift from Gerald Schwank (Addgene plasmid # 176478 ; http://n2t.net/addgene:176478 ; RRID:Addgene_176478) -
For your References section:
Replacing the SpCas9 HNH domain by deaminases generates compact base editors with an alternative targeting scope. Villiger L, Schmidheini L, Mathis N, Rothgangl T, Marquart K, Schwank G. Mol Ther Nucleic Acids. 2021 Aug 26;26:502-510. doi: 10.1016/j.omtn.2021.08.025. eCollection 2021 Dec 3. 10.1016/j.omtn.2021.08.025 PubMed 34631280
Map uploaded by the depositor.
