pCAG-mDrc7-FLAG
(Plasmid #176470)

• Purpose: Expression vector of mouse dynein regulatory complex subunit 7 (Drc7) tagged with FLAG at C-terminus.
• Depositing Lab: Masahito Ikawa
• Publication: Morohoshi et al PLoS Genet. 2020 Jan 21;16(1):e1008585. doi: 10.1371/journal.pgen.1008585. eCollection 2020 Jan.

Backbone

• Vector backbone: pCAG1.1
• Backbone size w/o insert (bp): 5169
• Total vector size (bp): 7815
• Modifications to backbone: pCAGGS was used as an original vector. FLAG sequence was added.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dynein regulatory complex subunit 7
• Alt name: Drc7
• Species: M. musculus (mouse)
• Insert Size (bp): 2646
• Entrez Gene: Drc7 (a.k.a. Ccdc135, Gm770, SR, SRG-L, SRG-S)
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCCTTCTTCTTTTTCCTACAGC
• 3′ sequencing primer: GCCACACCAGCCACCACCTTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry