pCAG-mTcte1-PA
(Plasmid #176469)

• Purpose: Expression vector of mouse t-complex-associated testis expressed 1 (Tcte1) tagged with PA at C-terminus.
• Depositing Lab: Masahito Ikawa
• Publication: Morohoshi et al PLoS Genet. 2020 Jan 21;16(1):e1008585. doi: 10.1371/journal.pgen.1008585. eCollection 2020 Jan.

Backbone

• Vector backbone: pCAG1.1
• Backbone size w/o insert (bp): 5205
• Total vector size (bp): 6717
• Modifications to backbone: pCAGGS was used as an original vector. PA sequence was added.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: t-complex-associated testis expressed 1
• Alt name: Tcte1
• Species: M. musculus (mouse)
• Insert Size (bp): 1512
• Entrez Gene: Tcte1 (a.k.a. D17S, D17Sil1, Tcte-1)
• Tag / Fusion Protein:
  • PA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GCCTTCTTCTTTTTCCTACAGC
• 3′ sequencing primer: GCCACACCAGCCACCACCTTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry