pCAG-mDrc3-PA
(Plasmid
#176467)
-
PurposeExpression vector of mouse dynein regulatory complex subunit 3 (Drc3) tagged with PA at C-terminus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5211
- Total vector size (bp) 6798
-
Modifications to backbonepCAGGS was used as an original vector. PA sequence was added.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedynein regulatory complex subunit 3
-
Alt nameDrc3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1587
-
Entrez GeneDrc3 (a.k.a. 4930449E07Rik, Lrr, Lrrc48, m6Be, m6Bei)
-
Tag
/ Fusion Protein
- PA (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-mDrc3-PA was a gift from Masahito Ikawa (Addgene plasmid # 176467 ; http://n2t.net/addgene:176467 ; RRID:Addgene_176467) -
For your References section:
Nexin-Dynein regulatory complex component DRC7 but not FBXL13 is required for sperm flagellum formation and male fertility in mice. Morohoshi A, Miyata H, Shimada K, Nozawa K, Matsumura T, Yanase R, Shiba K, Inaba K, Ikawa M. PLoS Genet. 2020 Jan 21;16(1):e1008585. doi: 10.1371/journal.pgen.1008585. eCollection 2020 Jan. 10.1371/journal.pgen.1008585 PubMed 31961863