pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
(Plasmid
#176460)
-
PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting HEK3 site driven by EF1alpha promoter and EGFP(L138S)-P2A-mCherry driven by CMV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepiggyBac-EF1alpha
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHH-HEK3 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
-
gRNA/shRNA sequenceggcccagactgagcacgtga
-
SpeciesSynthetic
-
Insert Size (bp)461
- Promoter EF1alpha
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid name in Yang lab: HGpl569
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA was a gift from Hui Yang (Addgene plasmid # 176460 ; http://n2t.net/addgene:176460 ; RRID:Addgene_176460) -
For your References section:
Precise genome editing without exogenous donor DNA via retron editing system in human cells. Kong X, Wang Z, Zhang R, Wang X, Zhou Y, Shi L, Yang H. Protein Cell. 2021 Aug 17. pii: 10.1007/s13238-021-00862-7. doi: 10.1007/s13238-021-00862-7. 10.1007/s13238-021-00862-7 PubMed 34403072