Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
(Plasmid #176460)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176460 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    piggyBac-EF1alpha
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HH-HEK3 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
  • gRNA/shRNA sequence
    ggcccagactgagcacgtga
  • Species
    Synthetic
  • Insert Size (bp)
    461
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid name in Yang lab: HGpl569

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA was a gift from Hui Yang (Addgene plasmid # 176460 ; http://n2t.net/addgene:176460 ; RRID:Addgene_176460)
  • For your References section:

    Precise genome editing without exogenous donor DNA via retron editing system in human cells. Kong X, Wang Z, Zhang R, Wang X, Zhou Y, Shi L, Yang H. Protein Cell. 2021 Aug 17. pii: 10.1007/s13238-021-00862-7. doi: 10.1007/s13238-021-00862-7. 10.1007/s13238-021-00862-7 PubMed 34403072