Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA3-myc-his-BACH1 P47A
(Plasmid #17644)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17644 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(+)/myc-His A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5493
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BACH1
  • Alt name
    BRIP1
  • Alt name
    FANCJ
  • Species
    H. sapiens (human)
  • Mutation
    To generate the tumor-associated mutant, the proline at position 47 was changed to an alanine by Quikchange site-directed mutagenesis (Stratagene) using the following primers: [CATTGTTTGTTGGAGAGTGCCACAGGAAGTGGAAAAGC] and [GCTTTTTCCACTTCCTGTGGCACTCTCCAACAAACAATG]
  • GenBank ID
    AF360549
  • Entrez Gene
    BRIP1 (a.k.a. BACH1, FANCJ, OF)
  • Tags / Fusion Proteins
    • Myc (C terminal on backbone)
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Apa1 (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3-myc-his-BACH1 P47A was a gift from Ronny Drapkin (Addgene plasmid # 17644 ; http://n2t.net/addgene:17644 ; RRID:Addgene_17644)
  • For your References section:

    The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Cantor S, Drapkin R, Zhang F, Lin Y, Han J, Pamidi S, Livingston DM. Proc Natl Acad Sci U S A. 2004 Feb 24. 101(8):2357-62. 10.1073/pnas.0308717101 PubMed 14983014