Skip to main content
Addgene

pACYC-T7CyDisCo
(Plasmid #176405)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176405 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACYC184-TU2A-RFP
  • Backbone size w/o insert (bp) 5068
  • Total vector size (bp) 6527
  • Modifications to backbone
    Modified pACYC184 for GoldenGate compatibility with an internal RFP gene for negative selection
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Mitochondrial FAD-linked sulfhydryl oxidase
  • Alt name
    Erv1p
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    189
  • Mutation
    Codon optimised for expression in E. coli
  • GenBank ID
    NP_011543
  • Entrez Gene
    ERV1 (a.k.a. YGR029W)
  • Promoter T7 promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer ATGAAGGCTATTGACAAGATGAC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Protein disulfide isomerase
  • Alt name
    PDI
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    492
  • Mutation
    deleted amino acids 2-17, codon optimised for expression in E. coli
  • GenBank ID
    NP_000909
  • Promoter T7 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer ATGGACGCACCTGAAGAG
  • 3′ sequencing primer CAATTCATCCTTTACTGCTTTCT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-T7CyDisCo was a gift from Simon Williams (Addgene plasmid # 176405)

  • For your References section:

    Optimised production of disulfide-bonded fungal effectors in E. coli using CyDisCo and FunCyDisCo co-expression approaches. Yu DS, Outram MA, Crean E, Smith A, Sung Y, Darma R, Sun X, Ma L, Jones DA, Solomon PS, Williams SJ. bioRxiv 2021.08.31.458447 10.1101/2021.08.31.458447
Related items: