Skip to main content
Addgene

pACYC-T7FunCyDisCo
(Plasmid #176404)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176404 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACYC184-TU2A-RFP
  • Backbone size w/o insert (bp) 5068
  • Total vector size (bp) 6491
  • Modifications to backbone
    Modified pACYC184 for GoldenGate compatibility with an internal RFP gene for negative selection
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    FAD-linked sulfhydryl oxidase ERV2 from Fol
  • Alt name
    Fol Erv2
  • Species
    Fusarium oxysporum
  • Insert Size (bp)
    552
  • Mutation
    deleted amino acids 2-25, codon optimised for E. coli expression
  • GenBank ID
    FOXG_09255
  • Promoter T7 promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (unknown if destroyed)
  • 3′ cloning site Esp3I (unknown if destroyed)
  • 5′ sequencing primer ATGAGCGGCCC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Protein disulfide isomerase from Fol
  • Alt name
    Fol PDI
  • Species
    Fusarium oxysporum
  • Insert Size (bp)
    1467
  • Mutation
    deleted amino acids 2-20, codon optimised for expression in E. coli
  • GenBank ID
    FOXG_00140
  • Promoter T7 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (unknown if destroyed)
  • 3′ cloning site Esp3I (unknown if destroyed)
  • 5′ sequencing primer ATGGCAGATAGTGACGTCCA
  • 3′ sequencing primer CAATTCGTCATGGACGTCTTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-T7FunCyDisCo was a gift from Simon Williams (Addgene plasmid # 176404)

  • For your References section:

    Optimised production of disulfide-bonded fungal effectors in E. coli using CyDisCo and FunCyDisCo co-expression approaches. Yu DS, Outram MA, Crean E, Smith A, Sung Y, Darma R, Sun X, Ma L, Jones DA, Solomon PS, Williams SJ. bioRxiv 2021.08.31.458447 10.1101/2021.08.31.458447
Related items: