pSLfa-PUb-EGFP-3'UTR#13
(Plasmid
#176338)
-
PurposeThe synthetic 3'UTR#13 for EGFP expression under the control of the Ae. aegypti polyubiquitin (PUb) promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSLfa
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3'UTR#13
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer AGAAGCGCGATCACATGGTCCTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLfa-PUb-EGFP-3'UTR#13 was a gift from Zach Adelman (Addgene plasmid # 176338 ; http://n2t.net/addgene:176338 ; RRID:Addgene_176338) -
For your References section:
Novel synthetic 3'-untranslated regions for controlling transgene expression in transgenic Aedes aegypti mosquitoes. Chae K, Valentin C, Jakes E, Myles KM, Adelman ZN. RNA Biol. 2021 Aug 31:1-9. doi: 10.1080/15476286.2021.1971440. 10.1080/15476286.2021.1971440 PubMed 34464234