pAB2076 pAAV REPAIR.t1
(Plasmid #176323)

• Purpose: pAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)
• Depositing Lab: Feng Zhang
• Publication: Kannan et al Nat Biotechnol. 2021 Aug 30. pii: 10.1038/s41587-021-01030-2. doi: 10.1038/s41587-021-01030-2.

Backbone

• Vector backbone: pAAV
• Total vector size (bp): 7411
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: human codon optimized Cas13bt1 (catalytically inactivated)
• Species: Atlantic deep subsurface metagenome
• Insert Size (bp): 2409
• Mutation: R95A/H100A/R769A/H773A
• Promoter: EFS (short EF1alpha)
• Tag / Fusion Protein:
  • HIV NES (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccgccagaacacaggaaactta

Gene/Insert 2

• Gene/Insert name: huADAR2dd(E488Q)
• Alt name: human ADAR2 deaminase domain
• Species: H. sapiens (human)
• Insert Size (bp): 1158
• Mutation: E488Q, only the deaminase domain (aa 276-702 are expressed)
• Entrez Gene: ADARB1 (a.k.a. ADAR2, DRABA2, DRADA2, NEDHYMS, RED1)
• Tag / Fusion Protein:
  • 3xHA (C terminal on insert)

Gene/Insert 3

• Gene/Insert name: Cas13bt1 crRNA + BpiI cloning site
• Species: Atlantic deep subsurface metagenome
• Insert Size (bp): 57
• Promoter: hU6

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • pab2076-paav-efs-cas13b-t1-huadar2e488q-3xha-bghpau6-eco31i-cas13b-t1-dr.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry