Hy_pMtnA FFLuc SV40
(Plasmid
#176299)
-
PurposeExpresses firefly luciferase (FFLuc) mRNA from the Drosophila Metallothionein A promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHy_pMtnA eGFP
- Total vector size (bp) 8865
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly luciferase
- Promoter MtnA
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC
- 3′ sequencing primer CTACCTGCCTGGACAGCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMtnA FFLuc SV40 was a gift from Jeremy Wilusz (Addgene plasmid # 176299 ; http://n2t.net/addgene:176299 ; RRID:Addgene_176299) -
For your References section:
CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells. Ai Y, Liang D, Wilusz JE. Nucleic Acids Res. 2022 Mar 4. pii: 6542487. doi: 10.1093/nar/gkac159. 10.1093/nar/gkac159 PubMed 35244715