pMVS184
(Plasmid
#176294)
-
PurposeReporter_ZIFUAS_minCMVpromoter_GFP_AAVS1_Puromycin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZDoner
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6835
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter and GFP
- Promoter 4x Zinc finger binding sites and mini CMV promoter
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccgtttaaacccgctgatca
- 3′ sequencing primer GTAAGTTGCATCGCCCTCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.28.359026v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVS184 was a gift from Max Staller (Addgene plasmid # 176294 ; http://n2t.net/addgene:176294 ; RRID:Addgene_176294) -
For your References section:
Directed mutational scanning reveals a balance between acidic and hydrophobic residues in strong human activation domains. Staller MV, Ramirez E, Kotha SR, Holehouse AS, Pappu RV, Cohen BA. Cell Syst. 2022 Apr 20;13(4):334-345.e5. doi: 10.1016/j.cels.2022.01.002. Epub 2022 Feb 3. 10.1016/j.cels.2022.01.002 PubMed 35120642