Skip to main content
Addgene

pMVS184
(Plasmid #176294)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176294 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pZDoner
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6835
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Promoter and GFP
  • Promoter 4x Zinc finger binding sites and mini CMV promoter
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccgtttaaacccgctgatca
  • 3′ sequencing primer GTAAGTTGCATCGCCCTCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMVS184 was a gift from Max Staller (Addgene plasmid # 176294 ; http://n2t.net/addgene:176294 ; RRID:Addgene_176294)
  • For your References section:

    Directed mutational scanning reveals a balance between acidic and hydrophobic residues in strong human activation domains. Staller MV, Ramirez E, Kotha SR, Holehouse AS, Pappu RV, Cohen BA. Cell Syst. 2022 Apr 20;13(4):334-345.e5. doi: 10.1016/j.cels.2022.01.002. Epub 2022 Feb 3. 10.1016/j.cels.2022.01.002 PubMed 35120642