pAAV-SynI-CreOn-FlpOff-mNaChBacMUT-P2A-EGFP
(Plasmid #176281)

• Purpose: Viral vector for co-expression of non-functional NaChBac and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.
• Depositing Lab: Martin Riccomagno
• Publication: Ubina et al J Cell Sci. 2021 Oct 15;134(20). pii: 272538. doi: 10.1242/jcs.257212. Epub 2021 Oct 20.

Backbone

• Vector backbone: pAAV-SynI
• Backbone manufacturer: Vector Builder
• Backbone size w/o insert (bp): 4605
• Total vector size (bp): 6228
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mNaChBacMUT-P2A-EGFP
• Alt name: Bacterial voltage gated Na+ channel
• Species: Synthetic
• Mutation: E191K
• Promoter: human Synapsin I

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV-SynI-CreOn-FlpOff-mNaChBacMUT-P2A-EGFP.gbk
• A portion of this plasmid was derived from a plasmid made by: Massimo Scanziani; Addgene #60657

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Several differences were found flanking/near the lox and frt sites. These base changes do not affect the coding sequence or recombination sites.