pAAV-SynI-FlpOn-CreOff-MCS-P2A-mCherry
(Plasmid #176277)

• Purpose: Viral vector for co-expression of a CDS of interest and mCherry in cells expressing Flp AND NOT Cre driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.
• Depositing Lab: Martin Riccomagno
• Publication: Ubina et al J Cell Sci. 2021 Oct 15;134(20). pii: 272538. doi: 10.1242/jcs.257212. Epub 2021 Oct 20.

Backbone

• Vector backbone: pAAV-SynI
• Backbone manufacturer: Vector Builder
• Backbone size w/o insert (bp): 4592
• Total vector size (bp): 5520
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MCS-P2A-mCherry
• Species: Synthetic
• Insert Size (bp): 928
• Promoter: human Synapsin I

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TTGGTCACCTTCAGCTTGG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV-SynI-FlpOn-CreOff-MCS-P2A-mCherry.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry