pAAV-SynI-FlpOn-CreOff-TdTomato
(Plasmid
#176275)
-
PurposeViral vector for expression of TdTomato in cells expressing Flp AND NOT Cre driven by the human Synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-SynI
-
Backbone manufacturerVector Builder
- Backbone size w/o insert (bp) 4278
- Total vector size (bp) 6050
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
Alt nametandem dimer Tomato
-
SpeciesSynthetic
-
Insert Size (bp)1772
- Promoter human Synapsin I
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGTTCCTGTACGGCATGG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SynI-FlpOn-CreOff-TdTomato was a gift from Martin Riccomagno (Addgene plasmid # 176275 ; http://n2t.net/addgene:176275 ; RRID:Addgene_176275) -
For your References section:
ExBoX - a simple Boolean exclusion strategy to drive expression in neurons. Ubina T, Vahedi-Hunter T, Agnew-Svoboda W, Wong W, Gupta A, Santhakumar V, Riccomagno MM. J Cell Sci. 2021 Oct 15;134(20). pii: 272538. doi: 10.1242/jcs.257212. Epub 2021 Oct 20. 10.1242/jcs.257212 PubMed 34515305