pNOC_hfnCas12a-Nlux_crRNA NR1
(Plasmid #176244)

• Purpose: pNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1
• Depositing Lab: John van der Oost
• Publication: Naduthodi et al ACS Synth Biol. 2021 Dec 17;10(12):3369-3378. doi: 10.1021/acssynbio.1c00329. Epub 2021 Nov 18.

Backbone

• Vector backbone: pUC19
• Vector type: CRISPR, Luciferase, Synthetic Biology ; Expression in microalgae Nannochloropsis oceanica
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized fnCas12a
• Species: Francisella novicida
• Promoter: Ribosomal subunit
• Tag / Fusion Protein:
  • luciferase (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCTACTCGTCTCTCTTGG
• 3′ sequencing primer: TCCTGGCCTTTCTTAGCATCG

Resource Information

• Supplemental Documents:
  • pnoc_hfncas12a-nlux_crrna-nr1.gb
• A portion of this plasmid was derived from a plasmid made by: The backbone of plasmid was a gift from Eva Farre from Michigan State University. And the Cas12a sequence was obtained from the Addgene plasmid # 69976

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry