Skip to main content
Addgene

pNOC_hlbCas12a-Nlux
(Plasmid #176240)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176240 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR, Luciferase, Synthetic Biology ; Expression in microalgae Nannochloropsis oceanica
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized lbCas12a
  • Species
    Lachnospiraceae bacterium
  • Promoter Ribosomal subunit
  • Tag / Fusion Protein
    • luciferase (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTACTCGTCTCTCTTGG
  • 3′ sequencing primer GCTCGAGGGTTGCGTGTGTAT
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The backbone of plasmid was a gift from Eva Farre from Michigan State University. And the Cas12a sequence was obtained from the Addgene plasmid # 69988

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNOC_hlbCas12a-Nlux was a gift from John van der Oost (Addgene plasmid # 176240 ; http://n2t.net/addgene:176240 ; RRID:Addgene_176240)

  • For your References section:

    Comprehensive Genome Engineering Toolbox for Microalgae Nannochloropsis oceanica Based on CRISPR-Cas Systems. Naduthodi MIS, Sudfeld C, Avitzigiannis EK, Trevisan N, van Lith E, Alcaide Sancho J, D'Adamo S, Barbosa M, van der Oost J. ACS Synth Biol. 2021 Dec 17;10(12):3369-3378. doi: 10.1021/acssynbio.1c00329. Epub 2021 Nov 18. 10.1021/acssynbio.1c00329 PubMed 34793143
Related items:
Commonly requested with: