Skip to main content
Addgene

pTmpKmH207out
(Plasmid #176231)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176231 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMW118
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cI of phage lambda, hok of the R1 plasmid, neo, truncated PH207 promoter of T5 phage

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer cagggttttcccagtcacga
  • 3′ sequencing primer atgttgtgtggaattgtgagc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTmpKmH207out was a gift from Sergey Sineoky (Addgene plasmid # 176231 ; http://n2t.net/addgene:176231 ; RRID:Addgene_176231)

  • For your References section:

    Robust counterselection and advanced lambdaRed recombineering enable markerless chromosomal integration of large heterologous constructs. Bubnov DM, Yuzbashev TV, Khozov AA, Melkina OE, Vybornaya TV, Stan GB, Sineoky SP. Nucleic Acids Res. 2022 Aug 26;50(15):8947-8960. doi: 10.1093/nar/gkac649. 10.1093/nar/gkac649 PubMed 35920321
Related items: