pRedCmOcr
(Plasmid
#176226)
-
PurposeA helper plasmid for expression of the artificial T7ocr-gam-bet-exo operon. The plasmid carries the chloramphenicol acetyltransferase gene repressible by the CI repressor of lambda phage.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE-30
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe plasmid confers resistance to chloramphenicol only in absence of CI repressor of lambda phage.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLambda Red-T7ocr operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
- Promoter PrhaB and PL
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctttttgcgtttctacaaactc
- 3′ sequencing primer tggactcaagacgatagttac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRedCmOcr was a gift from Sergey Sineoky (Addgene plasmid # 176226 ; http://n2t.net/addgene:176226 ; RRID:Addgene_176226) -
For your References section:
Robust counterselection and advanced lambdaRed recombineering enable markerless chromosomal integration of large heterologous constructs. Bubnov DM, Yuzbashev TV, Khozov AA, Melkina OE, Vybornaya TV, Stan GB, Sineoky SP. Nucleic Acids Res. 2022 Aug 26;50(15):8947-8960. doi: 10.1093/nar/gkac649. 10.1093/nar/gkac649 PubMed 35920321