pRedCm
(Plasmid #176225)

• Purpose: LambdaRed-expressing plasmid carrying the chloramphenicol acetyltransferase gene repressible by the CI repressor of lambda phage
• Depositing Lab: Sergey Sineoky
• Publication: Bubnov et al Nucleic Acids Res. 2022 Aug 26;50(15):8947-8960. doi: 10.1093/nar/gkac649.

Backbone

• Vector backbone: pQE-30
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The plasmid confers resistance to chloramphenicol only in absence of CI repressor of lambda phage.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
• Promoter: PrhaB and PL

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctttttgcgtttctacaaactc
• 3′ sequencing primer: tggactcaagacgatagttac

Resource Information

• Supplemental Documents:
  • pRedCm.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry