pSA10(gfcD-10xHis)
(Plasmid
#176192)
-
PurposegfcD protein expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSA10
-
Backbone manufacturerfrom Dr Shoshi Altuvia
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegfcD
-
Alt nameymcA
-
SpeciesE. coli E2348/69 O127:H6
- Promoter Ptac
-
Tag
/ Fusion Protein
- 10xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (unknown if destroyed)
- 3′ cloning site PstI (unknown if destroyed)
- 5′ sequencing primer GCTCGTATAATGTGTGGAATTG
- 3′ sequencing primer CGATGGTGTCAACGTAAATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from pSA10(GfcD) by mutagenesis
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSA10(gfcD-10xHis) was a gift from Mark Saper (Addgene plasmid # 176192 ; http://n2t.net/addgene:176192 ; RRID:Addgene_176192) -
For your References section:
Escherichia coli O127 group 4 capsule proteins assemble at the outer membrane. Larson MR, Biddle K, Gorman A, Boutom S, Rosenshine I, Saper MA. PLoS One. 2021 Nov 15;16(11):e0259900. doi: 10.1371/journal.pone.0259900. eCollection 2021. 10.1371/journal.pone.0259900 PubMed 34780538