pX459-dMET
(Plasmid
#176031)
-
PurposeA knock-out vector for dog MET
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX459
-
Backbone manufacturerhttps://www.addgene.org/48139/
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA gRNA targeting the dog MET gene and the cDNA of Cas9
-
gRNA/shRNA sequenceTGGGTGGAAGGATATGTCGC
-
Insert Size (bp)5000
-
Entrez GeneMET (a.k.a. c-Met)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-dMET was a gift from Michiyuki Matsuda (Addgene plasmid # 176031 ; http://n2t.net/addgene:176031 ; RRID:Addgene_176031) -
For your References section:
A feedback loop between lamellipodial extension and HGF-ERK signaling specifies leader cells during collective cell migration. Hino N, Matsuda K, Jikko Y, Maryu G, Sakai K, Imamura R, Tsukiji S, Aoki K, Terai K, Hirashima T, Trepat X, Matsuda M. Dev Cell. 2022 Oct 10;57(19):2290-2304.e7. doi: 10.1016/j.devcel.2022.09.003. Epub 2022 Sep 28. 10.1016/j.devcel.2022.09.003 PubMed 36174555