Halo-WIPI2B R108E
(Plasmid #176004)

• Purpose: Expresses WIPI2B (R108E) fused to Halo in mammalian cells
• Depositing Lab: Erika Holzbaur
• Publication: Stavoe et al Elife. 2019 Jul 16;8. pii: 44219. doi: 10.7554/eLife.44219.

Backbone

• Vector backbone: pHTN
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6143
• Total vector size (bp): 7410
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: WIPI2B (R108E)
• Species: H. sapiens (human)
• Mutation: Arginine 108 to Glutamate
• Entrez Gene: WIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
• Promoter: CMV
• Tag / Fusion Protein:
  • HaloTag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: cctgatcggcagcgagatcg

Resource Information

• Supplemental Documents:
  • phtn-halo-wipi2b-r108e.gb
• A portion of this plasmid was derived from a plasmid made by: Sharon Tooze, Francis Crick Institute, UK
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry