HisMS2_VLP_FluA
(Plasmid
#175955)
-
PurposeGeneration of MS2 Virus-Like Particles packaged with the sequence for the Influenza A Matrix Protein [A/Illinois/20/2018(H1N1)]
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMC037-HisMS2_PLP_pac
- Backbone size w/o insert (bp) 5593
- Total vector size (bp) 5593
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM gene
-
SpeciesInfluenza A
-
Insert Size (bp)982
-
GenBank ID
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (BsmBI) (destroyed during cloning)
- 3′ cloning site Esp3I (BsmBI) (destroyed during cloning)
- 5′ sequencing primer TGTCGAACAGAAAGTAATCGTATTGTAC
- 3′ sequencing primer CAGCTGGCACGACAGGTTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.17.24305965 for medRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HisMS2_VLP_FluA was a gift from Paul Freemont (Addgene plasmid # 175955 ; http://n2t.net/addgene:175955 ; RRID:Addgene_175955) -
For your References section:
A standardised, high-throughput approach to diagnostic group testing method validation. Unruh LAH, Crone MA, Freemont PS, Chindelevitch L. medRxiv 2024.04.17.24305965 10.1101/2024.04.17.24305965