Skip to main content
Addgene

pSIN-Gapdh
(Plasmid #175938)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175938 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSIN
  • Backbone size w/o insert (bp) 7097
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gapdh gRNA
  • gRNA/shRNA sequence
    gACTTACCCCGGCCTTCTCCA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gapdh (a.k.a. Gapd)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BBS I (destroyed during cloning)
  • 3′ cloning site BBS I (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • 3′ sequencing primer AAAAAAGCACCGACTCGGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-Gapdh was a gift from Dan Littman (Addgene plasmid # 175938 ; http://n2t.net/addgene:175938 ; RRID:Addgene_175938)
  • For your References section:

    Niche-Selective Inhibition of Pathogenic Th17 Cells by Targeting Metabolic Redundancy. Wu L, Hollinshead KER, Hao Y, Au C, Kroehling L, Ng C, Lin WY, Li D, Silva HM, Shin J, Lafaille JJ, Possemato R, Pacold ME, Papagiannakopoulos T, Kimmelman AC, Satija R, Littman DR. Cell. 2020 Aug 6;182(3):641-654.e20. doi: 10.1016/j.cell.2020.06.014. Epub 2020 Jul 1. 10.1016/j.cell.2020.06.014 PubMed 32615085