Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p63_AF043
(Plasmid #175878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175878 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSEVA631
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 8089
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AF043 cassette
  • Species
    Synthetic

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttctgtatgtgtcgtcggca
  • 3′ sequencing primer GTTCTGAGGTCATTACTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The araC-ParaBAD-mTagBFP2 cassette comes from plasmid pBAD-mTagBFP2 (Plasmid #34632). The luxI gene and the luxR-Plux cassette come from plasmid pTD103luxI_sfGFP (Plasmid #48885). The vector backbone came from the SEVA collection.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p63_AF043 was a gift from Chris Barnes (Addgene plasmid # 175878 ; http://n2t.net/addgene:175878 ; RRID:Addgene_175878)
  • For your References section:

    Single strain control of microbial consortia. Fedorec AJH, Karkaria BD, Sulu M, Barnes CP. Nat Commun. 2021 Mar 30;12(1):1977. doi: 10.1038/s41467-021-22240-x. 10.1038/s41467-021-22240-x PubMed 33785746