pENTR4 CDS A. thaliana PARP1
(Plasmid
#175818)
-
PurposepENTR4 plasmid with CDS of Arabidopsis thaliana POLY(ADP-RIBOSE) POLYMERASE 1 (PARP1, AT2G31320.1) without stop codon for C-terminal epitope tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR4
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 2235
- Total vector size (bp) 5184
-
Vector typepENTR plasmid for Gateway cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePARP1
-
Alt nameAT2G31320.1
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2949
-
Mutationone silent mutation, annotated in GenBank file
-
GenBank IDNM_179834
-
Entrez GenePARP1 (a.k.a. AT2G31320, ATPARP2, F16D14.16, F16D14_16, POLY(ADP-RIBOSE) POLYMERASE 1, poly(ADP-ribose) polymerase 2)
- Promoter none
-
Tags
/ Fusion Proteins
- none
- none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCGCCATAAACTGCCAGG
- 3′ sequencing primer CGTTGAATATGGCTCATAACACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR4 CDS A. thaliana PARP1 was a gift from Lennart Wirthmueller (Addgene plasmid # 175818 ; http://n2t.net/addgene:175818 ; RRID:Addgene_175818)