Skip to main content
Addgene

pENTR4 CDS A. thaliana PARP2
(Plasmid #175810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175810 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR4
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 2235
  • Total vector size (bp) 4146
  • Vector type
    pENTR plasmid for Gateway cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PARP2
  • Alt name
    AT4G02390.1
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1911
  • GenBank ID
    NM_116472
  • Entrez Gene
    PARP2 (a.k.a. AT4G02390, APP, ATPARP1, PARP1, POLY(ADP-RIBOSE) POLYMERASE, POLY(ADP-RIBOSE) POLYMERASE 1, PP, T14P8.19, T14P8_19, poly(ADP-ribose) polymerase, poly(ADP-ribose) polymerase 2)
  • Promoter none
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCGCCATAAACTGCCAGG
  • 3′ sequencing primer CGTTGAATATGGCTCATAACACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR4 CDS A. thaliana PARP2 was a gift from Lennart Wirthmueller (Addgene plasmid # 175810 ; http://n2t.net/addgene:175810 ; RRID:Addgene_175810)
  • For your References section:

    Nuclear Import of Arabidopsis Poly(ADP-Ribose) Polymerase 2 Is Mediated by Importin-alpha and a Nuclear Localization Sequence Located Between the Predicted SAP Domains. Chen C, Masi R, Lintermann R, Wirthmueller L. Front Plant Sci. 2018 Nov 1;9:1581. doi: 10.3389/fpls.2018.01581. eCollection 2018. 10.3389/fpls.2018.01581 PubMed 30455710