pET17b-yebST
(Plasmid
#175804)
-
PurposeComplementation of yebST knockout in E. coli K-12
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175804 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET17b
- Backbone size w/o insert (bp) 3187
- Total vector size (bp) 7073
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyebST
-
Alt nameletAB
-
SpeciesEscherichia coli K-12
-
Insert Size (bp)3886
-
Mutationsilent mutations to introduce restriction sites
- Promoter T7
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer agaggccccaaggggttatgcta (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was cloned in the lab of Professor Ian Henderson
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET17b-yebST was a gift from Gira Bhabha & Damian Ekiert & Ian Henderson (Addgene plasmid # 175804 ; http://n2t.net/addgene:175804 ; RRID:Addgene_175804) -
For your References section:
MCE domain proteins: conserved inner membrane lipid-binding proteins required for outer membrane homeostasis. Isom GL, Davies NJ, Chong ZS, Bryant JA, Jamshad M, Sharif M, Cunningham AF, Knowles TJ, Chng SS, Cole JA, Henderson IR. Sci Rep. 2017 Aug 17;7(1):8608. doi: 10.1038/s41598-017-09111-6. 10.1038/s41598-017-09111-6 PubMed 28819315