Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
(Plasmid #175801)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175801 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET29b
  • Backbone size w/o insert (bp) 5322
  • Total vector size (bp) 7245
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Dispersin B
  • Alt name
    DspB
  • Species
    Aggregatibacter actinomycetemcomitans
  • Insert Size (bp)
    1104
  • Mutation
    E184Q W330Y
  • GenBank ID
    AAP31025
  • Promoter T7
  • Tags / Fusion Proteins
    • AviTag (N terminal on insert)
    • eGFP (N terminal on insert)
    • Hexahistidine tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GGCCTGAACGACATCTTCGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis was a gift from Mark Nitz (Addgene plasmid # 175801 ; http://n2t.net/addgene:175801 ; RRID:Addgene_175801)
  • For your References section:

    An Inactive Dispersin B Probe for Monitoring PNAG Production in Biofilm Formation. Eddenden A, Kitova EN, Klassen JS, Nitz M. ACS Chem Biol. 2020 May 15;15(5):1204-1211. doi: 10.1021/acschembio.9b00907. Epub 2020 Jan 21. 10.1021/acschembio.9b00907 PubMed 31917539