pET29b-eGFP-dspB(E184Q)-6xHis
(Plasmid #175783)

• Purpose: Plasmid for overexpression of recombinant His-tagged fusion protein eGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.
• Depositing Lab: Mark Nitz
• Publication: Eddenden et al ACS Chem Biol. 2020 May 15;15(5):1204-1211. doi: 10.1021/acschembio.9b00907. Epub 2020 Jan 21.

Backbone

• Vector backbone: pET29b
• Backbone size w/o insert (bp): 5322
• Total vector size (bp): 7194
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Dispersin B
• Alt name: DspB
• Species: Aggregatibacter actinomycetemcomitans
• Insert Size (bp): 1104
• Mutation: E184Q
• GenBank ID: AAP31025
• Promoter: T7
• Tags / Fusion Proteins:
  • eGFP (N terminal on insert)
  • Hexahistidine tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pdb02-pet29begfp-dspb-e184q-6xhis.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: The plasmid contains a S267P mutation in the insert. This mutation is in an unimportant flexible linker region and should not impact plasmid function.