pBPGUw
(Plasmid #17575)

• Depositing Lab: Gerald Rubin
• Publication: Pfeiffer et al Tools for neuroanatomy and neurogenetics in Drosophila

Backbone

• Vector backbone: pBDP
• Backbone size w/o insert (bp): 9052
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: Bacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GAL4
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2646
• Entrez Gene: GAL4 (a.k.a. YPL248C, GAL81)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: BDP F (bp 11,652): AAATAGGGGTTCCGCGCACAT
• 3′ sequencing primer: BDP R (bp 5,435) : ATAATGGTGCAGGGCGCTGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).
• Articles Citing this Plasmid:
  • 33 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.