pNUT1
(Plasmid
#175746)
-
PurposeSingle-component photo-inducible (LOV2-based) nucleolus-targeting tool 1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTriEx
- Total vector size (bp) 6162
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry-LOV2-NoLS (HIV Rev transactivating protein)
-
Alt namepNUT1
-
SpeciesSynthetic
-
Insert Size (bp)1224
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer T7: TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNUT1 was a gift from Yubin Zhou (Addgene plasmid # 175746 ; http://n2t.net/addgene:175746 ; RRID:Addgene_175746) -
For your References section:
Optical control of protein delivery and partitioning in the nucleolus. Tan P, Hong T, Cai X, Li W, Huang Y, He L, Zhou Y. Nucleic Acids Res. 2022 Mar 23. pii: 6553118. doi: 10.1093/nar/gkac191. 10.1093/nar/gkac191 PubMed 35325178