pBPGw
(Plasmid #17574)

• Depositing Lab: Gerald Rubin
• Publication: Pfeiffer et al Tools for neuroanatomy and neurogenetics in Drosophila

Backbone

• Vector backbone: pBDP
• Backbone size w/o insert (bp): 8902
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: Bacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GAL4
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2646
• Entrez Gene: GAL4 (a.k.a. YPL248C, GAL81)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: BDP F (bp 11,503): AAATAGGGGTTCCGCGCACAT
• 3′ sequencing primer: BDP R (bp 5,286) : ATAATGGTGCAGGGCGCTGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.