-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 17574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBDP
- Backbone size w/o insert (bp) 8902
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsBacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAL4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2646
-
Entrez GeneGAL4 (a.k.a. YPL248C, GAL81)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer BDP F (bp 11,503): AAATAGGGGTTCCGCGCACAT
- 3′ sequencing primer BDP R (bp 5,286) : ATAATGGTGCAGGGCGCTGAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBPGw was a gift from Gerald Rubin (Addgene plasmid # 17574 ; http://n2t.net/addgene:17574 ; RRID:Addgene_17574) -
For your References section:
Tools for Neuroanatomy and Neurogenetics in Drosophila. Pfeiffer BD, Jenett A, Hammonds AS, Ngo TT, Misra S, Murphy C, Scully A, Carlson JW, Wan KH, Laverty TR, Mungall C, Svirskas R, Kadonaga JT, Doe CQ, Eisen MB, Celniker SE, Rubin GM.. Tools for neuroanatomy and neurogenetics in Drosophila 10.1073/pnas.0803697105 PubMed 18621688
Map uploaded by Addgene staff.
Map uploaded by the depositor.