Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBPGw
(Plasmid #17574)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17574 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBDP
  • Backbone size w/o insert (bp) 8902
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    Bacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAL4
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2646
  • Entrez Gene
    GAL4 (a.k.a. YPL248C, GAL81)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer BDP F (bp 11,503): AAATAGGGGTTCCGCGCACAT
  • 3′ sequencing primer BDP R (bp 5,286) : ATAATGGTGCAGGGCGCTGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPGw was a gift from Gerald Rubin (Addgene plasmid # 17574 ; http://n2t.net/addgene:17574 ; RRID:Addgene_17574)
  • For your References section:

    Tools for Neuroanatomy and Neurogenetics in Drosophila. Pfeiffer BD, Jenett A, Hammonds AS, Ngo TT, Misra S, Murphy C, Scully A, Carlson JW, Wan KH, Laverty TR, Mungall C, Svirskas R, Kadonaga JT, Doe CQ, Eisen MB, Celniker SE, Rubin GM.. Tools for neuroanatomy and neurogenetics in Drosophila 10.1073/pnas.0803697105 PubMed 18621688