Skip to main content
Addgene

pBDP
(Plasmid #17566)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17566 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    na
  • Backbone size w/o insert (bp) 2482
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mini w+
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    4119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer BDP F (bp 6,556): AAATAGGGGTTCCGCGCACAT
  • 3′ sequencing primer BDP R (bp 339): ATAATGGTGCAGGGCGCTGAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBDP is a modular minimal cloning vector for specific in vivo genomic
targeting of Drosophila melanogaster using PhiC31 integrase. The vector
contains mini w+ flanked by AscI sites for easy exchange to any marker of
choice as well as a large MCS, and the pMB1 ori from pUC19.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBDP was a gift from Gerald Rubin (Addgene plasmid # 17566 ; http://n2t.net/addgene:17566 ; RRID:Addgene_17566)

  • For your References section:

    Tools for Neuroanatomy and Neurogenetics in Drosophila. Pfeiffer BD, Jenett A, Hammonds AS, Ngo TT, Misra S, Murphy C, Scully A, Carlson JW, Wan KH, Laverty TR, Mungall C, Svirskas R, Kadonaga JT, Doe CQ, Eisen MB, Celniker SE, Rubin GM.. Tools for neuroanatomy and neurogenetics in Drosophila 10.1073/pnas.0803697105 PubMed 18621688
Related items:
Commonly requested with: