FLAG-Foxo1-WT 6KR
(Plasmid #17560)

• Depositing Lab: Domenico Accili
• Publication: Kitamura et al Cell Metab. 2005 Sep . 2(3):153-63.

Backbone

• Vector backbone: pCMV5
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Foxo1 6KR
• Alt name: Foxo1
• Alt name: Fkhr
• Alt name: forkhead box O1
• Species: M. musculus (mouse)
• Insert Size (bp): 1700
• Mutation: K242, K245, K259, K262, K271 and K291 were replaced with arginine.
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Myc (N terminal on backbone)
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CMV-F; pCEP-F
• 3′ sequencing primer: hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid has K219R and L619P polymorphisms which are not thought to affect plasmid function.