pMesh1
(Plasmid #175594)

• Purpose: Lac inducible, AMP Resistant, non labelled gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.
• Depositing Lab: Greg Bokinsky
• Publication: Buke et al Curr Biol. 2022 Feb 28;32(4):870-877.e5. doi: 10.1016/j.cub.2021.12.033. Epub 2022 Jan 5.

Backbone

• Vector backbone: pBbA5a
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Mesh1
• Species: D. melanogaster (fly)
• Insert Size (bp): 537
• Mutation: Codon optimized for translation in E.coli. AGGAGGAAAAAA RBS added before the start codon
• Entrez Gene: Mesh1 (a.k.a. Dmel_CG11900, CG11900, Dmel\CG11900, Q9VAM9)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GCGTAGAGGATCGAGATCG
• 3′ sequencing primer: GTGTGACTCTAGTAGAGAGCG

Resource Information

• Supplemental Documents:
  • p15A-AmpR-sRBS-Mesh1.gb
• A portion of this plasmid was derived from a plasmid made by: Mesh1 is cloned from synthetic codon optimized DNA we ordered from a company

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry