-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322-SV40
- Backbone size w/o insert (bp) 3102
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFoxO4
-
Alt nameforkhead box O4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1518
-
Entrez GeneFOXO4 (a.k.a. AFX, AFX1, MLLT7)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site BglII (unknown if destroyed)
- 5′ sequencing primer CCCCATGGCTGACTAATTTTT
- 3′ sequencing primer EBV-Rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-Foxo4 was a gift from Domenico Accili (Addgene plasmid # 17549 ; http://n2t.net/addgene:17549 ; RRID:Addgene_17549)