Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pExpreS2-1-C3-PA
(Plasmid #175446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175446 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pExpreS2-1
  • Backbone manufacturer
    ExpreS2ion Biotechnologies
  • Backbone size (bp) 3156
  • Modifications to backbone
    Added HiFi-compatible MCS which introduces an N-terminal BiP secretion peptide and a C-terminal, 3C-cleavable Protein A tag
  • Vector type
    Insect Expression
  • Promoter Fused Actin-HSP70
  • Selectable markers
    Zeocin
  • Tags / Fusion Proteins
    • BiP Secretion Peptide (N terminal on insert)
    • 3C-Protein A (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAAGACAGGTTTAAGGAGAC
  • 3′ sequencing primer GCGCTTGAAAGGAGTGTGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pExpreS2-1-C3-PA was a gift from Wyatt Yue (Addgene plasmid # 175446 ; http://n2t.net/addgene:175446 ; RRID:Addgene_175446)
  • For your References section:

    FAS2FURIOUS: Moderate-Throughput Secreted Expression of Difficult Recombinant Proteins in Drosophila S2 Cells. Coker JA, Katis VL, Fairhead M, Schwenzer A, Clemmensen SB, Frandsen BU, de Jongh WA, Gileadi O, Burgess-Brown NA, Marsden BD, Midwood KS, Yue WW. Front Bioeng Biotechnol. 2022 May 5;10:871933. doi: 10.3389/fbioe.2022.871933. eCollection 2022. 10.3389/fbioe.2022.871933 PubMed 35600892