pCAG-lox-rox-STOP-rox-tRFP-pA-lox-ZsGreen-pA
(Plasmid #175438)

• Purpose: dual plasmid labelling cells of different neuronal population with different fluorophores
• Depositing Labs: Frank Bradke, Sebastián Dupraz
• Publication: Alfadil et al J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068.

Backbone

• Vector backbone: pCAG-loxSTOPlox-ZsGreen
• Backbone size w/o insert (bp): 5737
• Total vector size (bp): 7602
• Vector type: Mammalian Expression, Cre/Lox ; Dre/Rox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rox-STOP-rox-tRFP-pA
• Species: H. sapiens (human)
• Insert Size (bp): 1865
• Promoter: pCAG
• Tag / Fusion Protein:
  • ZsGreen on backbone (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: pCAG forward (GCAACGTGCTGGTTATTGTG)
• 3′ sequencing primer: ZsGreen reverse (5’- CTCCATGCGGTACTTCATGG -3’)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional Primers:
tRFP forward (5'-ACTTCGTGGACCACAGAC-3’) and tRFP reverse
(5'-CACTTGAAGTGGTGGTTG-3’)