p5155
(Plasmid #175391)

• Purpose: (Empty Backbone) Low Copy Number DNA Donor Vector for Bxb1 Integrase-mediated Cassette Exchange (for inserts >15kb) into dual site mouse strains (Bxb-GT/GA)
• Depositing Lab: Michael Wiles
• Publication: Low et al Sci Rep. 2022 Mar 31;12(1):5424. doi: 10.1038/s41598-022-09445-w.

Backbone

• Vector backbone: pBR322
• Backbone manufacturer: Genscript
• Backbone size (bp): 4361
• Modifications to backbone: replaced AMP-R gene (857bp, 3293-4149) with NEO/KAN-R gene (797bp, p5155: 760-1556). replaced 1366bp (4272-1276) with 174bp: Bxb1 attB(GT)/MCS/Bxb1 attB(GA) - (sequence 1769-1852 in p5155).
• Vector type: Mouse Targeting ; Cloning vector, to be used to deliver transgene into mice with dual heterologous Bxb1 attP sites

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: GATTGTCTGTTGTGCCCAGTCA
• 3′ sequencing primer: CGCGTATCGGTGATTCATTCT

Resource Information

• Supplemental Documents:
  • p5155 Sequence (Snapgene)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We recommend this low-copy plasmid for the generation of donor DNA when the inserted transgene size is >15kb. For smaller transgene insertions, we recommend the high-copy plasmid p5154 (Addgene 175390).