p5154
(Plasmid #175390)

• Purpose: (Empty Backbone) High Copy Number DNA Donor Vector for Bxb1 Integrase-mediated Cassette Exchange (for inserts <15kb) into dual site mouse strains (Bxb-GT/GA)
• Depositing Lab: Michael Wiles
• Publication: Low et al Sci Rep. 2022 Mar 31;12(1):5424. doi: 10.1038/s41598-022-09445-w.

Backbone

• Vector backbone: pUC18
• Backbone manufacturer: Genscript
• Backbone size (bp): 2686
• Modifications to backbone: replaced 69bp: bases 396-464 (MCS) in pUC18 with 199bp: Bxb1 attB(GT)/MCS/Bxb1 attB(GA) - (sequence 1457-1654 in p5154)
• Vector type: Mouse Targeting ; Cloning vector, to be used to deliver transgene into mice with dual heterologous Bxb1 attP sites

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Depending on the nature of the sequence cloned into this plasmid, it may be beneficial to grow using NEB Stable, at 30C. However, just to maintain p5154 alone, DH5alpha is adequate (though we generally use DH10Beta).
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: GCCACCTGACGTCTAAGAAA
• 3′ sequencing primer: GGGAAACGCCTGGTATCTTTA

Resource Information

• Supplemental Documents:
  • p5154 Sequence (Snapgene)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We recommend this plasmid for the generation of the DNA donor when the inserted transgene size is <15kb. For larger insertions, we recommend the low-copy plasmid p5155 (175391).

Depending on the nature of the sequence cloned into this plasmid, it may be beneficial to grow using NEB Stable, at 30C. However, just to maintain p5154 alone, DH5alpha is adequate (though we generally use DH10Beta).