Skip to main content
Addgene

pAAV hSyn GFP-Cre
(Plasmid #175381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175381 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV hSyn
  • Backbone size w/o insert (bp) 4561
  • Total vector size (bp) 6382
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-Cre recombinase
  • Species
    Synthetic
  • Insert Size (bp)
    1821
  • Promoter human synapsin
  • Tag / Fusion Protein
    • Cre is fused to GFP. GFP is fused to additional nuclear localization signals. (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gcaccacgcgaggcgcgagat
  • 3′ sequencing primer caaccaggatttatacaagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Wei Xu UTSW
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn GFP-Cre was a gift from Jason Aoto (Addgene plasmid # 175381 ; http://n2t.net/addgene:175381 ; RRID:Addgene_175381)