pAAV hSyn GFP-Cre
(Plasmid
#175381)
-
Purposeexpresses GFP-Cre under the control of a human synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV hSyn
- Backbone size w/o insert (bp) 4561
- Total vector size (bp) 6382
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-Cre recombinase
-
SpeciesSynthetic
-
Insert Size (bp)1821
- Promoter human synapsin
-
Tag
/ Fusion Protein
- Cre is fused to GFP. GFP is fused to additional nuclear localization signals. (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gcaccacgcgaggcgcgagat
- 3′ sequencing primer caaccaggatttatacaagg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Wei Xu UTSW
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn GFP-Cre was a gift from Jason Aoto (Addgene plasmid # 175381 ; http://n2t.net/addgene:175381 ; RRID:Addgene_175381)