pAAV hSyn GFP-Cre
(Plasmid #175381)

• Purpose: expresses GFP-Cre under the control of a human synapsin promoter
• Depositing Lab: Jason Aoto
• Publication: Widespread inhibitory projections from the cerebellar interposed nucleus (unpublished)

Backbone

• Vector backbone: pAAV hSyn
• Backbone size w/o insert (bp): 4561
• Total vector size (bp): 6382
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-Cre recombinase
• Species: Synthetic
• Insert Size (bp): 1821
• Promoter: human synapsin
• Tag / Fusion Protein:
  • Cre is fused to GFP. GFP is fused to additional nuclear localization signals. (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gcaccacgcgaggcgcgagat
• 3′ sequencing primer: caaccaggatttatacaagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Wei Xu UTSW
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry