-
PurposeAAV vector for mapping synaptic projections of infected neurons; expresses tdTomato to reveal neuronal soma and axons, and expresses EGFP fused to Synaptobrevin-2 to track synaptic terminals.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 4561
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-Synaptobrevin-2; tdTomato
-
Insert Size (bp)2576
-
Entrez GeneVamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- tdTomato (P2A cleavage) (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SynaptoTAG2 was a gift from Wei Xu (Addgene plasmid # 175275 ; http://n2t.net/addgene:175275 ; RRID:Addgene_175275) -
For your References section:
Anterograde transneuronal tracing and genetic control with engineered yellow fever vaccine YFV-17D. Li E, Guo J, Oh SJ, Luo Y, Oliveros HC, Du W, Arano R, Kim Y, Chen YT, Eitson J, Lin DT, Li Y, Roberts T, Schoggins JW, Xu W. Nat Methods. 2021 Nov 25. pii: 10.1038/s41592-021-01319-9. doi: 10.1038/s41592-021-01319-9. 10.1038/s41592-021-01319-9 PubMed 34824475