pAAV-SynaptoTAG2
(Plasmid #175275)

• Purpose: AAV vector for mapping synaptic projections of infected neurons; expresses tdTomato to reveal neuronal soma and axons, and expresses EGFP fused to Synaptobrevin-2 to track synaptic terminals.
• Depositing Lab: Wei Xu
• Publication: Li et al Nat Methods. 2021 Nov 25. pii: 10.1038/s41592-021-01319-9. doi: 10.1038/s41592-021-01319-9.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 4561
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP-Synaptobrevin-2; tdTomato
• Insert Size (bp): 2576
• Entrez Gene: Vamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
• Promoter: Synapsin
• Tags / Fusion Proteins:
  • EGFP (N terminal on insert)
  • tdTomato (P2A cleavage) (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning

Resource Information

• Supplemental Documents:
  • AAV-SynaptoTAG2 updated.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)