Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FKBP-YPet-RanGAP*
(Plasmid #175245)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MTTH
  • Backbone manufacturer
    lab reagent
  • Backbone size w/o insert (bp) 5300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RANGAP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1695
  • Mutation
    Amino acid 562 F to A
  • Entrez Gene
    RANGAP1 (a.k.a. Fug1, RANGAP, SD)
  • Promoter tac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FKBP-YPet-RanGAP* was a gift from Michael Rosen (Addgene plasmid # 175245 ; http://n2t.net/addgene:175245 ; RRID:Addgene_175245)
  • For your References section:

    Mechanistic dissection of increased enzymatic rate in a phase-separated compartment. Peeples W, Rosen MK. Nat Chem Biol. 2021 Jun;17(6):693-702. doi: 10.1038/s41589-021-00801-x. Epub 2021 May 25. 10.1038/s41589-021-00801-x PubMed 34035521