EGFP-RanGAP*
(Plasmid
#175237)
-
PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the Km
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMTTH
-
Backbone manufacturerlab reagent
- Backbone size w/o insert (bp) 5300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRANGAP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1332
-
MutationAmino acid 562 F to A
-
Entrez GeneRANGAP1 (a.k.a. Fug1, RANGAP, SD)
- Promoter tac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-RanGAP* was a gift from Michael Rosen (Addgene plasmid # 175237 ; http://n2t.net/addgene:175237 ; RRID:Addgene_175237) -
For your References section:
Mechanistic dissection of increased enzymatic rate in a phase-separated compartment. Peeples W, Rosen MK. Nat Chem Biol. 2021 Jun;17(6):693-702. doi: 10.1038/s41589-021-00801-x. Epub 2021 May 25. 10.1038/s41589-021-00801-x PubMed 34035521