pCFB8456
(Plasmid
#175208)
-
PurposeXenopus oocyte expression vector containing YEL004W. Contains T7 RNA polymerase binding site, and adds polyA tail to YEL004W. Used for generation of mRNA, for injection into xenopus laevis oocytes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNB1u/pLIFE016
- Backbone size w/o insert (bp) 3099
-
Vector typemRNA expression, injection into xenopus oocytes
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYEL004W
-
SpeciesS. cerevisiae (budding yeast)
- Promoter T7
-
Tag
/ Fusion Protein
- PolyA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nt.BbvCI (not destroyed)
- 3′ cloning site USER cloning (unknown if destroyed)
- 5′ sequencing primer AAGGCGATTAAGTTGGGT
- 3′ sequencing primer GTGTTCTTGAGGCTGGTTTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Generated by USER cloning
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFB8456 was a gift from Irina Borodina (Addgene plasmid # 175208 ; http://n2t.net/addgene:175208 ; RRID:Addgene_175208) -
For your References section:
Deorphanizing solute carriers in Saccharomyces cerevisiae for secondary uptake of xenobiotic compounds. Moller-Hansen I, Saez-Saez J, van der Hoek SA, Dyekjaer JD, Christensen HB, Wright Muelas M, O'Hagan S, Kell DB, Borodina I. Front Microbiol. 2024 Apr 12;15:1376653. doi: 10.3389/fmicb.2024.1376653. 10.3389/fmicb.2024.1376653 PubMed 38680917