pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1
(Plasmid
#175176)
-
PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Grpr
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
- Total vector size (bp) 7447
-
Modifications to backbonesgRNA targeting Grpr was inserted via BsaI restriction digest
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA-Grpr
-
gRNA/shRNA sequenceGrpr: atgataagcccataaactgc
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCloning was performed at the Genome engineering and iPSC center at Washington University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1 was a gift from Bernardo Sabatini (Addgene plasmid # 175176 ; http://n2t.net/addgene:175176 ; RRID:Addgene_175176) -
For your References section:
Bombesin-like peptide recruits disinhibitory cortical circuits and enhances fear memories. Melzer S, Newmark ER, Mizuno GO, Hyun M, Philson AC, Quiroli E, Righetti B, Gregory MR, Huang KW, Levasseur J, Tian L, Sabatini BL. Cell. 2021 Oct 28;184(22):5622-5634.e25. doi: 10.1016/j.cell.2021.09.013. Epub 2021 Oct 4. 10.1016/j.cell.2021.09.013 PubMed 34610277