Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1
(Plasmid #175176)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175176 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
  • Total vector size (bp) 7447
  • Modifications to backbone
    sgRNA targeting Grpr was inserted via BsaI restriction digest
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA-Grpr
  • gRNA/shRNA sequence
    Grpr: atgataagcccataaactgc

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloning was performed at the Genome engineering and iPSC center at Washington University

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1 was a gift from Bernardo Sabatini (Addgene plasmid # 175176 ; http://n2t.net/addgene:175176 ; RRID:Addgene_175176)
  • For your References section:

    Bombesin-like peptide recruits disinhibitory cortical circuits and enhances fear memories. Melzer S, Newmark ER, Mizuno GO, Hyun M, Philson AC, Quiroli E, Righetti B, Gregory MR, Huang KW, Levasseur J, Tian L, Sabatini BL. Cell. 2021 Oct 28;184(22):5622-5634.e25. doi: 10.1016/j.cell.2021.09.013. Epub 2021 Oct 4. 10.1016/j.cell.2021.09.013 PubMed 34610277