Addgene: pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-lacZ Skip to main content
Addgene

pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-lacZ
(Plasmid #175175)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175175 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
  • Total vector size (bp) 7448
  • Modifications to backbone
    sgRNA targeting lacZ was inserted via BsaI restriction digest
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA-lacZ
  • gRNA/shRNA sequence
    lacZ: catcgcgtgggcgtattcgca

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloning was performed at the Genome engineering and iPSC center at Washington University

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-lacZ was a gift from Bernardo Sabatini (Addgene plasmid # 175175 ; http://n2t.net/addgene:175175 ; RRID:Addgene_175175)
  • For your References section:

    Bombesin-like peptide recruits disinhibitory cortical circuits and enhances fear memories. Melzer S, Newmark ER, Mizuno GO, Hyun M, Philson AC, Quiroli E, Righetti B, Gregory MR, Huang KW, Levasseur J, Tian L, Sabatini BL. Cell. 2021 Oct 28;184(22):5622-5634.e25. doi: 10.1016/j.cell.2021.09.013. Epub 2021 Oct 4. 10.1016/j.cell.2021.09.013 PubMed 34610277