pQ54-VC
(Plasmid #175060)

• Purpose: expresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ54) in mammalian cells
• Depositing Lab: Arnold Boersma
• Publication: Wan et al Cell Rep Methods. 2022 Mar 28;2(3):100184. doi: 10.1016/j.crmeth.2022.100184. eCollection 2022 Mar 28.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 3944
• Total vector size (bp): 5678
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: polyQ54
• Alt name: polyQ54 tagged with mVenus-mCherry
• Species: H. sapiens (human)
• Insert Size (bp): 1734
• Mutation: mVenus: C-Terminal deletion of 11 aa (GITLGMDELYK); mCherry: C-Terminal deletion of 5 aa (DELYK) and N-Terminal deletion of 7 aa (MVSKGEE)
• GenBank ID: NM_002111.8
• Entrez Gene: HTT (a.k.a. HD, IT15, LOMARS)
• Promoter: CMV Promoter
• Tag / Fusion Protein:
  • mVenus + mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry